Skip to main content

pEGFP-N1-HPGD-FLAGC
(Plasmid #161915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 161915 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1-FLAGC
  • Backbone manufacturer
    Addgene #60360
  • Backbone size w/o insert (bp) 4706
  • Total vector size (bp) 5521
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HPGD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    803
  • Entrez Gene
    HPGD (a.k.a. 15-PGDH, PGDH, PGDH1, PHOAR1, SDR36C1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer SEQ-CMV-F (GTAGGCGTGTACGGTGGGAGG)
  • 3′ sequencing primer SEQ-GFPN-R (CTCCTCGCCCTTGCTCACC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-HPGD-FLAGC was a gift from Sébastien Britton (Addgene plasmid # 161915 ; http://n2t.net/addgene:161915 ; RRID:Addgene_161915)
  • For your References section:

    SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493