-
PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectable
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHW
-
Backbone manufacturerDrosophila Genomics Resource Center
- Total vector size (bp) 9532
-
Vector typeInsect Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehSpCas9
-
SpeciesSynthetic; ; S. pyogenes
-
Insert Size (bp)4890
- Promoter Ae. aegypti PUb
-
Tag
/ Fusion Protein
- T2A-pAc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer ACGTATTTGCTCCGTCACAT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA
-
SpeciesSynthetic
-
Insert Size (bp)193
- Promoter Ae. aegypti U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTGAGCTGATACCGCTCG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPeter Duchek, Addgene, pDCC6
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKRG3-mU6-PUb-hSpCas9-pAc was a gift from Charles Rice (Addgene plasmid # 162163 ; http://n2t.net/addgene:162163 ; RRID:Addgene_162163) -
For your References section:
A selectable, plasmid-based system to generate CRISPR/Cas9 gene edited and knock-in mosquito cell lines. Rozen-Gagnon K, Yi S, Jacobson E, Novack S, Rice CM. Sci Rep. 2021 Jan 12;11(1):736. doi: 10.1038/s41598-020-80436-5. 10.1038/s41598-020-80436-5 PubMed 33436886