pJYDNgp
(Plasmid
#162453)
-
PurposePositive control plasmid for pJYDNg carrying the eUnaG2 bilirubin dependent fluorescent protein fused to the C-terminus of Aga2p protein. This plasmid contains a long 2G linker.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162453 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneNew backbone pJYD
-
Backbone manufacturerDr. Jiri Zahradnik
- Backbone size w/o insert (bp) 5230
- Total vector size (bp) 5231
-
Modifications to backboneDeletion of two stop codons and the addition of one nucleotide in the MCS site.
-
Vector typeShuttle vector bacteria/yeast
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2p-2Glinker-eUnaG2
-
Insert Size (bp)915
-
Entrez GeneAGA2 (a.k.a. YGL032C)
- Promoter GAL1
-
Tags
/ Fusion Proteins
- HA nad myc (C terminal on insert)
- eUnaG2 fluorescent protein (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GaL1b_F primer: CCTCTATACTTTAACGTCAAGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.12.16.423176v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYDNgp was a gift from Gideon Schreiber (Addgene plasmid # 162453 ; http://n2t.net/addgene:162453 ; RRID:Addgene_162453) -
For your References section:
An enhanced yeast display platform demonstrates the binding plasticity under various selection pressures. Zahradník J, Dey D, Marciano S, Schreiber G. bioRxiv Preprint 2020 10.1101/2020.12.16.423176