pTM
(Plasmid
#162783)
-
Purpose(Empty Backbone) Protein expression in CHO cells - hTPA leader and C-terminal c-myc and 10xhis tags are coded
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 162783 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size (bp) 11914
-
Modifications to backboneTruncated EEF1A1 DFR and UFR sequences; hTPA signal peptide, c-myc, and 10xHis coding sequences added
-
Vector typeMammalian Expression
- Promoter CHO Elongation factor 1A
-
Selectable markersHT/MTX
-
Tags
/ Fusion Proteins
- hTPA leader (N terminal on backbone)
- c-myc (C terminal on backbone)
- 10xHis (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESArev aggtttccgggccctcacattg; SQ-MycH-R gatgaccgcctgcagac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTM was a gift from Ivan Vorobiev (Addgene plasmid # 162783 ; http://n2t.net/addgene:162783 ; RRID:Addgene_162783) -
For your References section:
High-level expression of the monomeric SARS-CoV-2 S protein RBD 320-537 in stably transfected CHO cells by the EEF1A1-based plasmid vector. Sinegubova MV, Orlova NA, Kovnir SV, Dayanova LK, Vorobiev II. PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021. 10.1371/journal.pone.0242890 PubMed 33529230