pTM-RBDv2
(Plasmid
#162785)
-
PurposeSARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size w/o insert (bp) 11914
- Total vector size (bp) 7436
-
Modifications to backboneTruncated EEF1A1 DFR and UFR sequences; hTPA signal peptide, c-myc, and 10xHis coding sequences added
-
Vector typeMammalian Expression
-
Selectable markersHT/MTX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 S protein receptor binding domain (RBD)
-
Alt nameSARS-CoV-2 Spike protein RBD
-
Alt nameSARS-CoV-2 Surface glycoprotein RBD
-
SpeciesSevere acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
-
Insert Size (bp)660
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
-
Tags
/ Fusion Proteins
- hTPA leader (N terminal on backbone)
- c-myc (C terminal on backbone)
- 10xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XmaI (destroyed during cloning)
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESArev aggtttccgggccctcacattg; SQ-MycH-R gatgaccgcctgcagac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe insert was synthesized according to https://www.nature.com/articles/s41591-020-0913-5, we excluded Lys319 from the N-terminus of the mature RBD protein, aiming at the maximization of signal peptide processing, and removed C-terminal amino acid residues Cys538-Val-Asn-Phe541
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTM-RBDv2 was a gift from Ivan Vorobiev (Addgene plasmid # 162785 ; http://n2t.net/addgene:162785 ; RRID:Addgene_162785) -
For your References section:
High-level expression of the monomeric SARS-CoV-2 S protein RBD 320-537 in stably transfected CHO cells by the EEF1A1-based plasmid vector. Sinegubova MV, Orlova NA, Kovnir SV, Dayanova LK, Vorobiev II. PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021. 10.1371/journal.pone.0242890 PubMed 33529230