pTM-RBDv2
(Plasmid #162785)

• Purpose: SARS-CoV-2 S protein receptor binding domain (RBD) expression in mammalian cells
• Depositing Lab: Ivan Vorobiev
• Publication: Sinegubova et al PLoS One. 2021 Feb 2;16(2):e0242890. doi: 10.1371/journal.pone.0242890. eCollection 2021.

Backbone

• Vector backbone: p1.1
• Backbone manufacturer: LMBT, LTD
• Backbone size w/o insert (bp): 11914
• Total vector size (bp): 7436
• Modifications to backbone: Truncated EEF1A1 DFR and UFR sequences; hTPA signal peptide, c-myc, and 10xHis coding sequences added
• Vector type: Mammalian Expression
• Selectable markers: HT/MTX

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 S protein receptor binding domain (RBD)
• Alt name: SARS-CoV-2 Spike protein RBD
• Alt name: SARS-CoV-2 Surface glycoprotein RBD
• Species: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)
• Insert Size (bp): 660
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
• Tags / Fusion Proteins:
  • hTPA leader (N terminal on backbone)
  • c-myc (C terminal on backbone)
  • 10xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XmaI (destroyed during cloning)
• 5′ sequencing primer: SQ-5CH6-F GCCGCTGCTTCCTGTGAC
• 3′ sequencing primer: IRESArev aggtttccgggccctcacattg; SQ-MycH-R gatgaccgcctgcagac

Resource Information

• Supplemental Documents:
  • pTM-RBDv2.gb
• A portion of this plasmid was derived from a plasmid made by: The insert was synthesized according to https://www.nature.com/articles/s41591-020-0913-5, we excluded Lys319 from the N-terminus of the mature RBD protein, aiming at the maximization of signal peptide processing, and removed C-terminal amino acid residues Cys538-Val-Asn-Phe541

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry