pTF-ACE2s
(Plasmid
#162786)
-
PurposeThe extracellular domain of Angiotensin converting enzyme 2 (ACE2) expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 162786 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep1.1
-
Backbone manufacturerLMBT, LTD
- Backbone size w/o insert (bp) 11914
- Total vector size (bp) 7436
-
Modifications to backboneTruncated EEF1A1 DFR and UFR sequences; FLAG-tag and 10xHis-tag coding sequences added
-
Vector typeMammalian Expression
-
Selectable markersHT/MTX
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAngiotensin-converting enzyme 2
-
Alt nameACE-2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2235
-
GenBank IDNM_021804
-
Entrez GeneACE2 (a.k.a. ACEH)
- Promoter CHO EEF1A1 (Translation Elongation Factor 1 Alpha 1)
-
Tags
/ Fusion Proteins
- hTPA leader (N terminal on insert)
- FLAG (C terminal on backbone)
- 10xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AbsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer SQ-5CH6-F GCCGCTGCTTCCTGTGAC
- 3′ sequencing primer IRESA rev aggtttccgggccctcacattg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byACE-2 extracellular domain was obtained using a PCR-product kindly provided by Petr V. Sergiev (Lomonosov Moscow State University, Moscow, Russia)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTF-ACE2s was a gift from Ivan Vorobiev (Addgene plasmid # 162786 ; http://n2t.net/addgene:162786 ; RRID:Addgene_162786) -
For your References section:
Fast and Accurate Surrogate Virus Neutralization Test Based on Antibody-Mediated Blocking of the Interaction of ACE2 and SARS-CoV-2 Spike Protein RBD. Kolesov DE, Sinegubova MV, Dayanova LK, Dolzhikova IV, Vorobiev II, Orlova NA. Diagnostics (Basel). 2022 Feb 3;12(2). pii: diagnostics12020393. doi: 10.3390/diagnostics12020393. 10.3390/diagnostics12020393 PubMed 35204485