Skip to main content

pET-NT*-HRV3CP
(Plasmid #162795)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162795 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-47b(+)
  • Backbone size w/o insert (bp) 5011
  • Total vector size (bp) 6004
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human rhinovirus 14 3C protease
  • Alt name
    NT*-HRV3CP
  • Species
    Human rhinovirus 14 3C
  • Insert Size (bp)
    993
  • GenBank ID
    NP_740524.1
  • Promoter T7
  • Tag / Fusion Protein
    • NT* solubility tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-NT*-HRV3CP was a gift from Gottfried Otting (Addgene plasmid # 162795 ; http://n2t.net/addgene:162795 ; RRID:Addgene_162795)
  • For your References section:

    NT*-HRV3CP: an optimized construct of human rhinovirus 14 3C protease for high-yield expression and fast affinity-tag cleavage. Abdelkader EH, Otting G. J Biotechnol. 2020 Nov 6. pii: S0168-1656(20)30306-0. doi: 10.1016/j.jbiotec.2020.11.005. 10.1016/j.jbiotec.2020.11.005 PubMed 33166527

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More