Skip to main content

pCW-eGFP
(Plasmid #162823)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 162823 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Addgene plasmid pCW-Cas9 (plasmid#50661)
  • Backbone size w/o insert (bp) 7600
  • Total vector size (bp) 8329
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Insert Size (bp)
    720
  • Mutation
    V163A
  • Promoter Tet ON

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer pCW Seq F: AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer pCW Seq R: GAACGGACGTGAAGAATGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    eGFP was amplified from commercial cDNAs and switched with Cas9 from Addgene plasmid pCW-Cas9 (plasmid #50661).
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-eGFP was a gift from Matthew Steinhauser (Addgene plasmid # 162823 ; http://n2t.net/addgene:162823 ; RRID:Addgene_162823)
  • For your References section:

    Prolonged fasting drives a program of metabolic inflammation in human adipose tissue. Fazeli PK, Zhang Y, O'Keefe J, Pesaresi T, Lun M, Lawney B, Steinhauser ML. Mol Metab. 2020 Sep 28;42:101082. doi: 10.1016/j.molmet.2020.101082. 10.1016/j.molmet.2020.101082 PubMed 32992039