AAV-puro-BGHpA-TRE-pEF-tagRFP-T-NLS
(Plasmid
#163083)
-
PurposeDonor vector for integration of TagRFP-T reporter at AAVS1 safe harbor site via TALENs
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 163083 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
- Total vector size (bp) 9654
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTagRFP-T
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CACACCAGCCACCACCTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2020.09.09.290015 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-puro-BGHpA-TRE-pEF-tagRFP-T-NLS was a gift from Lacra Bintu (Addgene plasmid # 163083 ; http://n2t.net/addgene:163083 ; RRID:Addgene_163083) -
For your References section:
Nanobody-mediated control of gene expression and epigenetic memory. Van MV, Fujimori T, Bintu L. Nat Commun. 2021 Jan 22;12(1):537. doi: 10.1038/s41467-020-20757-1. 10.1038/s41467-020-20757-1 PubMed 33483487