pUHG10.3-TetO-Rs1
(Plasmid
#16313)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 16313 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUHG10-3
- Backbone size w/o insert (bp) 3705
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameh5HT4b Serotonin Receptor (Rs1 D100A RASSL)
-
Alt nameRs1
-
Alt nameD100A
-
Alt name5HT4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1745
-
MutationAdded FLAG tag; Changed Aspartic Acid 100 to Alanine.
-
Entrez GeneRS1 (a.k.a. RS, XLRS1)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCACGCTGTTTTGACCTCC
- 3′ sequencing primer CCCTGAAAACTTTGCCCCCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUHG10.3-TetO-Rs1 was a gift from Bruce Conklin (Addgene plasmid # 16313 ; http://n2t.net/addgene:16313 ; RRID:Addgene_16313) -
For your References section:
Osteoblast expression of an engineered Gs-coupled receptor dramatically increases bone mass. Hsiao EC, Boudignon BM, Chang WC, Bencsik M, Peng J, Nguyen TD, Manalac C, Halloran BP, Conklin BR, Nissenson RA. Proc Natl Acad Sci U S A. 2008 Jan 29. 105(4):1209-14. 10.1073/pnas.0707457105 PubMed 18212126