SOX2-P2A-tagBFP-HDR
(Plasmid
#163751)
-
PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 163751 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Scientific CloneJET
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 5507
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX2
-
Alt nameANOP3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2847
-
MutationDoes not contain start codon to avoid random integration and expression
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
-
Tag
/ Fusion Protein
- P2A-tagBFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (destroyed during cloning)
- 5′ sequencing primer CGACTCACTATAGGGAGAGCGGC
- 3′ sequencing primer AAGAACATCGATTTTCCATGGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HDR knock-in template for tagging the human endogenous SOX2 gene with tagBFP (402nm/457nm). Contains the SOX2 coding sequence without a start codon to avoid random integration and sequencing. C-terminal P2A-tagBFP tag induces expression of tagBFP together with SOX2, but these two proteins are self-cleaved and separated during translation. SOX2 HDR cassette is surrounded by sgRNA target sequences to allow linearization inside the cell. Use this construct together with Addgene #163752 gRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SOX2-P2A-tagBFP-HDR was a gift from Jennifer Mitchell (Addgene plasmid # 163751 ; http://n2t.net/addgene:163751 ; RRID:Addgene_163751) -
For your References section:
Epigenetic reprogramming of a distal developmental enhancer cluster drives SOX2 overexpression in breast and lung adenocarcinoma. Abatti LE, Lado-Fernandez P, Huynh L, Collado M, Hoffman MM, Mitchell JA. Nucleic Acids Res. 2023 Sep 22:gkad734. doi: 10.1093/nar/gkad734. 10.1093/nar/gkad734 PubMed 37738673