Skip to main content

VPS35 shRNA2
(Plasmid #163859)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 163859 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    D. Root (Addgene #10878)
  • Backbone size w/o insert (bp) 7026
  • Total vector size (bp) 7084
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VPS35 retromer complex component
  • gRNA/shRNA sequence
    AATCATGAGACAGTCGCATAT
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_018206
  • Entrez Gene
    VPS35 (a.k.a. MEM3, PARK17)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer 5’ CAA GGC TGT TAG AGA GAT AAT TGG A 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VPS35 shRNA2 was a gift from Lei Lu (Addgene plasmid # 163859 ; http://n2t.net/addgene:163859 ; RRID:Addgene_163859)
  • For your References section:

    A quantitative study of the Golgi retention of glycosyltransferases. Sun X, Mahajan D, Chen B, Song Z, Lu L. J Cell Sci. 2021 Oct 15;134(20). pii: 272560. doi: 10.1242/jcs.258564. Epub 2021 Oct 21. 10.1242/jcs.258564 PubMed 34533190