AAVS1_puro_CAG_HexaPro
(Plasmid
#164077)
-
PurposeTargeted integration of SARS-CoV-2 spike HexaPro variant into the AAVS1 genomic safe harbor locus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backboneAAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene plasmid # 68375)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV-2 S HexaPro
-
SpeciesSevere acute respiratory syndrome coronavirus 2
-
Insert Size (bp)3624
-
MutationEctodomain only (AAs 1-1208); 682-685 (furin site) replaced with 'GSAS'; F817P, A892P, A899P, A942P, K986P, V987P
-
GenBank IDMN908947
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CAG
-
Tags
/ Fusion Proteins
- HRV 3C cleavage site (before tags) (C terminal on insert)
- 8X His tag (C terminal on insert)
- 2X Strep-Tag II (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer GAGGGGCAAACAACAGATGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The promoter and insert elements were derived from SARS-CoV-2 S HexaPro, a gift from Jason McLellan (Addgene plasmid # 154754).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1_puro_CAG_HexaPro was a gift from Yannick Doyon (Addgene plasmid # 164077 ; http://n2t.net/addgene:164077 ; RRID:Addgene_164077) -
For your References section:
Artisanal production of prefusion-stabilized SARS-CoV-2 spikes. Rivest JF, Goupil C, Doyon Y. protocols.io 2021 10.17504/protocols.io.buyfnxtn