Skip to main content

AAVS1_puro_CAG_HexaPro
(Plasmid #164077)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164077 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene plasmid # 68375)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 S HexaPro
  • Species
    Severe acute respiratory syndrome coronavirus 2
  • Insert Size (bp)
    3624
  • Mutation
    Ectodomain only (AAs 1-1208); 682-685 (furin site) replaced with 'GSAS'; F817P, A892P, A899P, A942P, K986P, V987P
  • GenBank ID
    MN908947
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CAG
  • Tags / Fusion Proteins
    • HRV 3C cleavage site (before tags) (C terminal on insert)
    • 8X His tag (C terminal on insert)
    • 2X Strep-Tag II (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site BstBI (not destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer GAGGGGCAAACAACAGATGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The promoter and insert elements were derived from SARS-CoV-2 S HexaPro, a gift from Jason McLellan (Addgene plasmid # 154754).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1_puro_CAG_HexaPro was a gift from Yannick Doyon (Addgene plasmid # 164077 ; http://n2t.net/addgene:164077 ; RRID:Addgene_164077)
  • For your References section:

    Artisanal production of prefusion-stabilized SARS-CoV-2 spikes. Rivest JF, Goupil C, Doyon Y. protocols.io 2021 10.17504/protocols.io.buyfnxtn