AAVS1_puro_CAG_HexaPro
(Plasmid #164077)

• Purpose: Targeted integration of SARS-CoV-2 spike HexaPro variant into the AAVS1 genomic safe harbor locus
• Depositing Lab: Yannick Doyon
• Publication: Rivest et al protocols.io 2021

Backbone

• Vector backbone: AAVS1_Puro_PGK1_3xFLAG_Twin_Strep (Addgene plasmid # 68375)
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 S HexaPro
• Species: Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 3624
• Mutation: Ectodomain only (AAs 1-1208); 682-685 (furin site) replaced with 'GSAS'; F817P, A892P, A899P, A942P, K986P, V987P
• GenBank ID: MN908947
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CAG
• Tags / Fusion Proteins:
  • HRV 3C cleavage site (before tags) (C terminal on insert)
  • 8X His tag (C terminal on insert)
  • 2X Strep-Tag II (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: BstBI (not destroyed)
• 5′ sequencing primer: TCGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: GAGGGGCAAACAACAGATGG

Resource Information

• Supplemental Documents:
  • AAVS1_puro_CAG_HexaPro.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

The promoter and insert elements were derived from SARS-CoV-2 S HexaPro, a gift from Jason McLellan (Addgene plasmid # 154754).