pAAV-Tetoffbidir -Alb-luc
(Plasmid
#164078)
-
PurposeAAV vector with bidirectional promoter controls expression firefly Luciferase with TRE and Tet-off transactivator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164078 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV‐Tetbidir‐Alb‐luc
-
Backbone manufacturerDr Gloria Gonzalez‐Aseguinolaza
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7660
-
Modifications to backboneConvert tet-on to tet-off
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
SpeciesFirefly
-
Insert Size (bp)1653
- Promoter Albumin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catacgcaagggatttagtcaaac
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byalready present in the vector obtained from Dr Gloria Gonzalez‐Aseguinolaza. We modified from the vector from Tet-On to Tet-Off.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene QC NGS analysis identified a few sequence discrepancies in the plasmid backbone. The depositing laboratory has confirmed that these should not impact function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Tetoffbidir -Alb-luc was a gift from Shu Uin Gan (Addgene plasmid # 164078 ; http://n2t.net/addgene:164078 ; RRID:Addgene_164078) -
For your References section:
Development of a liver-specific Tet-off AAV8 vector for improved safety of insulin gene therapy for diabetes. Gan SU, Fu Z, Sia KC, Kon OL, Calne R, Lee KO. J Gene Med. 2019 Jan;21(1):e3067. doi: 10.1002/jgm.3067. Epub 2019 Jan 20. 10.1002/jgm.3067 PubMed 30592790