pCAG-mWasabi-G
(Plasmid
#164161)
-
PurposeExpresses mWasabi under the control of CAG promoter, basic vector, multiclonig site at C terminal
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164161 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4915
- Total vector size (bp) 5645
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemWasabi
-
Insert Size (bp)708
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGCTGTCTCATCATTTTGGCAAA
- 3′ sequencing primer GATAGGCAGCCTGCACCTGAGGAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-mWasabi-G was a gift from Isei Tanida (Addgene plasmid # 164161 ; http://n2t.net/addgene:164161 ; RRID:Addgene_164161) -
For your References section:
Two-color in-resin CLEM of Epon-embedded cells using osmium resistant green and red fluorescent proteins. Tanida I, Furuta Y, Yamaguchi J, Kakuta S, Oliva Trejo JA, Uchiyama Y. Sci Rep. 2020 Dec 14;10(1):21871. doi: 10.1038/s41598-020-78879-x. 10.1038/s41598-020-78879-x PubMed 33318540