Skip to main content

ACE2
(Plasmid #164219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKLV2
  • Backbone manufacturer
    Addgene plasmid 67974
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ACE2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2415
  • Mutation
    silent mutation to remove internal EcoRI site (GAATTC to AAATTC)
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer AGCAAATGAGCAGGGAGGCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmids 1786 and 67974
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACE2 was a gift from Sriram Neelamegham (Addgene plasmid # 164219 ; http://n2t.net/addgene:164219 ; RRID:Addgene_164219)
  • For your References section:

    Inhibition of SARS-CoV-2 viral entry upon blocking N- and O-glycan elaboration. Yang Q, Hughes TA, Kelkar A, Yu X, Cheng K, Park S, Huang WC, Lovell JF, Neelamegham S. Elife. 2020 Oct 26;9. pii: 61552. doi: 10.7554/eLife.61552. 10.7554/eLife.61552 PubMed 33103998