pHP138 Myc-TRF2-deltaB deltaM
(Plasmid
#164255)
-
Purposefor generation of mammalian cells with inducible expression of dominant negative TRF2 for induction of telomere crisis used together with any PiggyBac transposase plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHP138
- Backbone size w/o insert (bp) 7897
- Total vector size (bp) 9124
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Mutationdeletion of amino acids-86 and 496-542
-
GenBank IDNM_005652.4
- Promoter Tetracycline inducible promotor
-
Tag
/ Fusion Protein
- Myc (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gctcgtttagtgaaccgtcagat (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHP138 Myc-TRF2-deltaB deltaM was a gift from John Maciejowski (Addgene plasmid # 164255 ; http://n2t.net/addgene:164255 ; RRID:Addgene_164255) -
For your References section:
ER-directed TREX1 limits cGAS activation at micronuclei. Mohr L, Toufektchan E, von Morgen P, Chu K, Kapoor A, Maciejowski J. Mol Cell. 2021 Jan 12. pii: S1097-2765(20)30958-8. doi: 10.1016/j.molcel.2020.12.037. 10.1016/j.molcel.2020.12.037 PubMed 33476576