Skip to main content

pX459-CTNNB1-S45
(Plasmid #164587)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 164587 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Feng Zhang, Plasmid #62988)
  • Backbone size w/o insert (bp) 9158
  • Total vector size (bp) 9178
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CTNNB1 gRNA
  • gRNA/shRNA sequence
    TTGCCTTTACCACTCAGAGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer U6 FWD
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX459-CTNNB1-S45 was a gift from Renee van Amerongen (Addgene plasmid # 164587 ; http://n2t.net/addgene:164587 ; RRID:Addgene_164587)
  • For your References section:

    Quantitative live-cell imaging and computational modeling shed new light on endogenous WNT/CTNNB1 signaling dynamics. de Man SM, Zwanenburg G, van der Wal T, Hink MA, van Amerongen R. Elife. 2021 Jun 30;10. pii: 66440. doi: 10.7554/eLife.66440. 10.7554/eLife.66440 PubMed 34190040