mCherry-eDHFR-SIMvada
(Plasmid
#164649)
-
PurposeSIM mutant tagged with mCherry and eDHFR
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 164649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRMCE
-
Vector typeMammalian Expression, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSIMvada
-
SpeciesH. sapiens (human)
-
Insert Size (bp)69
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AflII (destroyed during cloning)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer ATTAGCCAGAAGTCAGATGCTC
- 3′ sequencing primer none
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySIM mutant from Michael Rosen Lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-eDHFR-SIMvada was a gift from Michael Lampson & Huaiying Zhang (Addgene plasmid # 164649 ; http://n2t.net/addgene:164649 ; RRID:Addgene_164649) -
For your References section:
Nuclear body phase separation drives telomere clustering in ALT cancer cells. Zhang H, Zhao R, Tones J, Liu M, Dilley RL, Chenoweth DM, Greenberg RA, Lampson MA. Mol Biol Cell. 2020 Aug 15;31(18):2048-2056. doi: 10.1091/mbc.E19-10-0589. Epub 2020 Jun 24. 10.1091/mbc.E19-10-0589 PubMed 32579423