Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1-Neo-TRE-CMV-Cre-rtTA
(Plasmid #165457)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 165457 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAVS1-Neo
  • Backbone size w/o insert (bp) 10785
  • Total vector size (bp) 11817
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    CRE
  • Insert Size (bp)
    1032
  • Promoter Tight TRE promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CTAGTAAAGCTTAGTACTGTCGAGTTTAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cre recombinase cDNA was amplified from pCAG-Cre, a gift from Dr Connie Cepko, Addgene plasmid # 13775
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Neo-TRE-CMV-Cre-rtTA was a gift from Madeline Lancaster (Addgene plasmid # 165457 ; http://n2t.net/addgene:165457 ; RRID:Addgene_165457)
  • For your References section:

    An early cell shape transition drives evolutionary expansion of the human forebrain. Benito-Kwiecinski S, Giandomenico SL, Sutcliffe M, Riis ES, Freire-Pritchett P, Kelava I, Wunderlich S, Martin U, Wray GA, McDole K, Lancaster MA. Cell. 2021 Apr 15;184(8):2084-2102.e19. doi: 10.1016/j.cell.2021.02.050. Epub 2021 Mar 24. 10.1016/j.cell.2021.02.050 PubMed 33765444