-
PurposeBacterial expression of alpha synuclein coupled to GFP via a TEV site for uptake studies
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK172
-
Backbone manufacturerVirginia Lee
-
Modifications to backboneA TEV site (ENLYFQG) was inserted following the 6x His tag, in frame with the start of the GFP sequence.
-
Vector typeBacterial Expression
-
Selectable markersnone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWhile DH5alpha can be used for plasmid maintenance and storage, BL21(DE3) should be used for protein production. We used an autoinduction protocol.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemouse synuclein (from V. Lee)
-
Alt nameaSyn
-
SpeciesM. musculus (mouse)
-
Mutationadded a TEV cleavage site sequence between synuclein and GFP
-
Entrez GeneSnca (a.k.a. NACP, alpha-Syn, alphaSYN)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Virginia Lee, University of Pennsylvania
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The original plasmid reference is:
"Selective imaging of internalized proteopathic a-synuclein seeds in primary neurons reveals mechanistic insight into transmission of synucleinopathies" JBC 2017, DOI 0.1074/jbc.M117.780296
Richard J. Karpowicz, Jr. , Conor M. Haney , Tiberiu S. Mihaila , Raizel M. Sandler , E. James Petersson, and Virginia M.-Y. Lee
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK172-α-syn-TEV-GFP was a gift from Iris Lindberg (Addgene plasmid # 166671 ; http://n2t.net/addgene:166671 ; RRID:Addgene_166671) -
For your References section:
A protease protection assay for the detection of internalized alpha-synuclein pre-formed fibrils. Jarvela TS, Chaplot K, Lindberg I. PLoS One. 2021 Jan 26;16(1):e0241161. doi: 10.1371/journal.pone.0241161. eCollection 2021. 10.1371/journal.pone.0241161 PubMed 33497415