Skip to main content

mCerulean3-Bcl-XL-s2193
(Plasmid #166749)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 166749 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    s2193
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Blasticidin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Bcl-XL
  • Alt name
    Bcl2 like protein 1 (Bcl2l1)
  • Species
    H. sapiens (human)
  • Entrez Gene
    BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
  • Promoter Human ferritin
  • Tag / Fusion Protein
    • mCerulean3 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
  • 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. BclXL sequence aligns with NCBI Reference Sequence: NM_001317919.2 of Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-XL. There is a flexible, 7 amino acid linker "SGLRSRE", between mCerulean3 and Bcl-XL. Selection with Blasticidin was used to generate BMK-DKO cells stably expressing this plasmid. Expression under control of Human ferritin promoter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCerulean3-Bcl-XL-s2193 was a gift from David Andrews (Addgene plasmid # 166749 ; http://n2t.net/addgene:166749 ; RRID:Addgene_166749)
  • For your References section:

    Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026