mCerulean3-Bcl-XL-s2193
(Plasmid
#166749)
-
PurposeExpress mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-XL, in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbones2193
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBcl-XL
-
Alt nameBcl2 like protein 1 (Bcl2l1)
-
SpeciesH. sapiens (human)
-
Entrez GeneBCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
- Promoter Human ferritin
-
Tag
/ Fusion Protein
- mCerulean3 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CCTTGAGTTTTGAGCGGAGCTAA
- 3′ sequencing primer TTACCCCTCTAGACCTGGAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bymCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. BclXL sequence aligns with NCBI Reference Sequence: NM_001317919.2 of Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-XL. There is a flexible, 7 amino acid linker "SGLRSRE", between mCerulean3 and Bcl-XL. Selection with Blasticidin was used to generate BMK-DKO cells stably expressing this plasmid. Expression under control of Human ferritin promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCerulean3-Bcl-XL-s2193 was a gift from David Andrews (Addgene plasmid # 166749 ; http://n2t.net/addgene:166749 ; RRID:Addgene_166749) -
For your References section:
Bim escapes displacement by BH3-mimetic anti-cancer drugs by double-bolt locking both Bcl-XL and Bcl-2. Liu Q, Osterlund EJ, Chi X, Pogmore J, Leber B, Andrews DW. Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689. 10.7554/eLife.37689 PubMed 30860026