mCerulean3-Bcl-XL-s2193
(Plasmid #166749)

• Purpose: Express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bcl-XL, in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.
• Depositing Lab: David Andrews
• Publication: Liu et al Elife. 2019 Mar 12;8. pii: 37689. doi: 10.7554/eLife.37689.

Backbone

• Vector backbone: s2193
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Blasticidin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Bcl-XL
• Alt name: Bcl2 like protein 1 (Bcl2l1)
• Species: H. sapiens (human)
• Entrez Gene: BCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
• Promoter: Human ferritin
• Tag / Fusion Protein:
  • mCerulean3 (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: CCTTGAGTTTTGAGCGGAGCTAA
• 3′ sequencing primer: TTACCCCTCTAGACCTGGAAAG

Resource Information

• Supplemental Documents:
  • mCerulean3-BclXL-s2193.gb
• A portion of this plasmid was derived from a plasmid made by: mCerulean3 received from Mark Rizzo PMID: 21479270 and cloned into this plasmid. BclXL sequence aligns with NCBI Reference Sequence: NM_001317919.2 of Homo sapiens BCL2 like 1 (BCL2L1), transcript variant 3, mRNA.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Transfection of this plasmid will express mCerulean3-fused to the N-terminus of Bcl-XL. There is a flexible, 7 amino acid linker "SGLRSRE", between mCerulean3 and Bcl-XL. Selection with Blasticidin was used to generate BMK-DKO cells stably expressing this plasmid. Expression under control of Human ferritin promoter.