Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pcDNA3.1-SARS2-Spike-D614G
(Plasmid #166850)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 166850 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 9300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike
  • Alt name
    spike glycoprotein
  • Species
    SARS-CoV-2 virus
  • Insert Size (bp)
    3819
  • GenBank ID
    43740568
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV
  • Tag / Fusion Protein
    • C9 (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer ccagaatagaatgacacctac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-SARS2-Spike-D614G was a gift from Neville Sanjana (Addgene plasmid # 166850 ; http://n2t.net/addgene:166850 ; RRID:Addgene_166850)
  • For your References section:

    The Spike D614G mutation increases SARS-CoV-2 infection of multiple human cell types. Daniloski Z, Jordan TX, Ilmain JK, Guo X, Bhabha G, tenOever BR, Sanjana NE. Elife. 2021 Feb 11;10. pii: 65365. doi: 10.7554/eLife.65365. 10.7554/eLife.65365 PubMed 33570490