pM116: CasRx VEGFA presgRNA
(Plasmid
#166868)
-
PurposeU6-driven expression of human VEGFA targeting presgRNA compatible with CasRx.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166868 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepXR004: CasRx pre-gRNA cloning backbone
-
Backbone manufacturerPlasmid #109054
- Backbone size w/o insert (bp) 2927
- Total vector size (bp) 2957
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman VEGFA targeting presgRNA
-
gRNA/shRNA sequenceTATGTGCTGGCCTTGGTGAGGTTTGATCCG
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer CTCCTTTCGCTTTCTTCCCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM116: CasRx VEGFA presgRNA was a gift from Guei-Sheung Liu (Addgene plasmid # 166868 ; http://n2t.net/addgene:166868 ; RRID:Addgene_166868) -
For your References section:
Methods for in vitro CRISPR/CasRx-Mediated RNA Editing. Chuang YF, Wang PY, Kumar S, Lama S, Lin FL, Liu GS. Front Cell Dev Biol. 2021 Jun 11;9:667879. doi: 10.3389/fcell.2021.667879. eCollection 2021. 10.3389/fcell.2021.667879 PubMed 34178991