pM122: pAAV-EFS-CasRx
(Plasmid
#166870)
-
PurposeAAV vector for expressing CasRx
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 166870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerCell Biolabs, Inc.
- Backbone size w/o insert (bp) 3316
- Total vector size (bp) 6316
-
Modifications to backboneRemove original sequences (CMV promoter, human b-globin intron, MCS, and hGH polyA signal) between 2 ITRs
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRfxCas13d
-
Alt nameCasRx
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)3000
- Promoter EFS
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe CasRx sequence was adopted from pXR001: EF1a-CasRx-2A-EGFP (#109049)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM122: pAAV-EFS-CasRx was a gift from Guei-Sheung Liu (Addgene plasmid # 166870 ; http://n2t.net/addgene:166870 ; RRID:Addgene_166870) -
For your References section:
Methods for in vitro CRISPR/CasRx-Mediated RNA Editing. Chuang YF, Wang PY, Kumar S, Lama S, Lin FL, Liu GS. Front Cell Dev Biol. 2021 Jun 11;9:667879. doi: 10.3389/fcell.2021.667879. eCollection 2021. 10.3389/fcell.2021.667879 PubMed 34178991