pM122: pAAV-EFS-CasRx
(Plasmid #166870)

• Purpose: AAV vector for expressing CasRx
• Depositing Lab: Guei-Sheung Liu
• Publication: Chuang et al Front Cell Dev Biol. 2021 Jun 11;9:667879. doi: 10.3389/fcell.2021.667879. eCollection 2021.

Backbone

• Vector backbone: pAAV-MCS
• Backbone manufacturer: Cell Biolabs, Inc.
• Backbone size w/o insert (bp): 3316
• Total vector size (bp): 6316
• Modifications to backbone: Remove original sequences (CMV promoter, human b-globin intron, MCS, and hGH polyA signal) between 2 ITRs
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RfxCas13d
• Alt name: CasRx
• Species: Ruminococcus flavefaciens XPD3002
• Insert Size (bp): 3000
• Promoter: EFS
• Tags / Fusion Proteins:
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: n/a
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • pm122-paav-efs-casrx.gb
• A portion of this plasmid was derived from a plasmid made by: The CasRx sequence was adopted from pXR001: EF1a-CasRx-2A-EGFP (#109049)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry