pM122: pAAV-EFS-CasRx
(Plasmid
#166870)
-
PurposeAAV vector for expressing CasRx
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 166870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerCell Biolabs, Inc.
- Backbone size w/o insert (bp) 3316
- Total vector size (bp) 6316
-
Modifications to backboneRemove original sequences (CMV promoter, human b-globin intron, MCS, and hGH polyA signal) between 2 ITRs
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRfxCas13d
-
Alt nameCasRx
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)3000
- Promoter EFS
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer n/a
- 3′ sequencing primer GAAATTTGTGATGCTATTGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe CasRx sequence was adopted from pXR001: EF1a-CasRx-2A-EGFP (#109049)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pM122: pAAV-EFS-CasRx was a gift from Guei-Sheung Liu (Addgene plasmid # 166870 ; http://n2t.net/addgene:166870 ; RRID:Addgene_166870) -
For your References section:
Methods for in vitro CRISPR/CasRx-Mediated RNA Editing. Chuang YF, Wang PY, Kumar S, Lama S, Lin FL, Liu GS. Front Cell Dev Biol. 2021 Jun 11;9:667879. doi: 10.3389/fcell.2021.667879. eCollection 2021. 10.3389/fcell.2021.667879 PubMed 34178991