-
PurposeEncodes an IPTG inducible recT from E. faecium Com15 used to ectopically express recT in Enterococcus for recombineering.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 167546 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneplZ12-Spec
-
Backbone manufacturerLuciano Marraffini
- Backbone size w/o insert (bp) 3729
- Total vector size (bp) 6411
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameE. faecium Com15 recT under an IPTG inducible promoter, with lacI
-
Insert Size (bp)2896
- Promoter IPTG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTATTATAACATGTATTCACGAACG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIPTG promoter and lacI was taken from pPM145, a gift from Luciano Marraffini.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.01.278044v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRecT_2 was a gift from Howard Hang (Addgene plasmid # 167546 ; http://n2t.net/addgene:167546 ; RRID:Addgene_167546) -
For your References section:
RecT recombinase expression enables efficient gene editing in Enterococcus. Chen V, Griffin ME, Maguin P, Varble A, Hang HC. Appl Environ Microbiol. 2021 Jul 7:AEM0084421. doi: 10.1128/AEM.00844-21. 10.1128/AEM.00844-21 PubMed 34232061