-
PurposeUsed for CRISPR-Cas9 mediated recomineering in Enterococcus. Can clone desired gRNA using BsaI digestion.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 167547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepVPL3004
-
Backbone manufacturerJan-Peter van Pijkeren
- Backbone size w/o insert (bp) 9747
- Total vector size (bp) 10249
-
Modifications to backboneErythromycin resistance was swapped for Chloramphenicol via chloramphenicol acetyl transferase. pUC19 origin or replication was inserted.
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 12.5 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namechloramphenicol acetyl transferase
-
Alt namecat
-
Insert Size (bp)651
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer TTGAAGTTAAATTAGATGCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepUC19 origin of replication
-
Alt nameori
-
Insert Size (bp)589
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTCGCTTTTGTAAATTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypUC19 origin of replication was cloned from pUC19 obtained from New England Biolabs. Chloramphenicol acetyltransferase was cloned from pKH12, a gift from Kelli Palmer.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.01.278044v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas9 was a gift from Howard Hang (Addgene plasmid # 167547 ; http://n2t.net/addgene:167547 ; RRID:Addgene_167547) -
For your References section:
RecT recombinase expression enables efficient gene editing in Enterococcus. Chen V, Griffin ME, Maguin P, Varble A, Hang HC. Appl Environ Microbiol. 2021 Jul 7:AEM0084421. doi: 10.1128/AEM.00844-21. 10.1128/AEM.00844-21 PubMed 34232061