Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGCP123-EbpA_g1
(Plasmid #153517)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 153517 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGCP123
  • Backbone manufacturer
    Nielsen et at mBio. 2012 Jul 24;3(4):e00177-12. doi: 10.1128/mBio.00177-12.
  • Backbone size w/o insert (bp) 2917
  • Total vector size (bp) 3182
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB kan 50 (E. coli, grow for 48 hours) BHI Kan 500 (E. faecalis)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pnisA-sgRNA(EbpA_g1)-dCas9 scaffold
  • gRNA/shRNA sequence
    acgccaggtgcttttcccga
  • Species
    Enterococcus faecalis

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gBlock sequence ready for InFusion
  • 3′ sequencing primer gBlock sequence ready for InFusion
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGCP123-EbpA_g1 was a gift from Kimberly Kline (Addgene plasmid # 153517 ; http://n2t.net/addgene:153517 ; RRID:Addgene_153517)
  • For your References section:

    Multiplex CRISPRi System Enables the Study of Stage-Specific Biofilm Genetic Requirements in Enterococcus faecalis. Afonina I, Ong J, Chua J, Lu T, Kline KA. mBio. 2020 Oct 20;11(5):e01101-20. doi: 10.1128/mBio.01101-20. 10.1128/mBio.01101-20 PubMed 33082254