Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #153516)


Item Catalog # Description Quantity Price (USD)
Plasmid 153516 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Gary Dunny
  • Backbone size w/o insert (bp) 8514
  • Total vector size (bp) 12621
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    erm 100
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
    inactivated dCas9 from Streptococcus pneumoniae
  • Promoter nisA

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cagcgagtcagtgagcgag
  • 3′ sequencing primer cgcgagcataataaacggctc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSP3545-dCas9Str was a gift from Kimberly Kline (Addgene plasmid # 153516 ; ; RRID:Addgene_153516)
  • For your References section:

    Multiplex CRISPRi System Enables the Study of Stage-Specific Biofilm Genetic Requirements in Enterococcus faecalis. Afonina I, Ong J, Chua J, Lu T, Kline KA. mBio. 2020 10.1128/mBio.01101-20