pMEH31 Lamp2b HA
(Plasmid
#168208)
-
PurposeMammalian expression of lysosome-associated membrane protein 2b fused to a C-terminal HA tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA 3.1+ Hygro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5578
- Total vector size (bp) 6847
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLamp2b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1269
-
Entrez GeneLAMP2 (a.k.a. CD107b, DND, LAMP-2, LAMPB, LGP-96, LGP110)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer BGHR TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byLamp2b cDNA was purchased from Open Biosystems
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMEH31 Lamp2b HA was a gift from Joshua Leonard (Addgene plasmid # 168208 ; http://n2t.net/addgene:168208 ; RRID:Addgene_168208) -
For your References section:
A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348