Skip to main content

pMEH303 NLS dTomato 6x high affinity MS2 loops
(Plasmid #168215)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 168215 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGIPZ
  • Backbone manufacturer
    Open Biosciences
  • Backbone size w/o insert (bp) 9592
  • Total vector size (bp) 10330
  • Modifications to backbone
    Includes 6 high affinity MS2 loops downstream of WPRE
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NLS dTomato
  • Species
    Synthetic
  • Insert Size (bp)
    738
  • Promoter CMV
  • Tag / Fusion Protein
    • NLS (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site N/A (unknown if destroyed)
  • 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer WPRE R ggagcaacatagttaagaatacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Hygromycin selection marker is not within the LTRs

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMEH303 NLS dTomato 6x high affinity MS2 loops was a gift from Joshua Leonard (Addgene plasmid # 168215 ; http://n2t.net/addgene:168215 ; RRID:Addgene_168215)
  • For your References section:

    A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348