pMEH303 NLS dTomato 6x high affinity MS2 loops
(Plasmid
#168215)
-
PurposeMammalian expression of nuclear-localized dTomato with 6 high affinity MS2 loops
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGIPZ
-
Backbone manufacturerOpen Biosciences
- Backbone size w/o insert (bp) 9592
- Total vector size (bp) 10330
-
Modifications to backboneIncludes 6 high affinity MS2 loops downstream of WPRE
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Bleocin (Zeocin), 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS dTomato
-
SpeciesSynthetic
-
Insert Size (bp)738
- Promoter CMV
-
Tag
/ Fusion Protein
- NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site N/A (unknown if destroyed)
- 5′ sequencing primer CMVF CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer WPRE R ggagcaacatagttaagaatacc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Hygromycin selection marker is not within the LTRs
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMEH303 NLS dTomato 6x high affinity MS2 loops was a gift from Joshua Leonard (Addgene plasmid # 168215 ; http://n2t.net/addgene:168215 ; RRID:Addgene_168215) -
For your References section:
A platform for actively loading cargo RNA to elucidate limiting steps in EV-mediated delivery. Hung ME, Leonard JN. J Extracell Vesicles. 2016 May 13;5:31027. doi: 10.3402/jev.v5.31027. eCollection 2016. PubMed 27189348