Tol2-LyzC-GFP-U6ac-rac2-guides
(Plasmid
#168241)
-
Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneR4R3 pDest
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namerac2 sgRNAs
-
gRNA/shRNA sequencegggccaatgcgagaccctgt/gggctgtatcccagagtccc
-
SpeciesD. rerio (zebrafish)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-LyzC-GFP-U6ac-rac2-guides was a gift from Qing Deng (Addgene plasmid # 168241 ; http://n2t.net/addgene:168241 ; RRID:Addgene_168241) -
For your References section:
A robust and flexible CRISPR/Cas9-based system for neutrophil-specific gene inactivation in zebrafish. Wang Y, Hsu AY, Walton EM, Park SJ, Syahirah R, Wang T, Zhou W, Ding C, Lemke AP, Zhang G, Tobin DM, Deng Q. J Cell Sci. 2021 Apr 15;134(8). pii: 237799. doi: 10.1242/jcs.258574. Epub 2021 Apr 22. 10.1242/jcs.258574 PubMed 33722979