pBAD-DiB2
(Plasmid
#168801)
-
PurposeFluorogen activating protein (FAP) DiB2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 168801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 3958
- Total vector size (bp) 4492
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFluorogen activating protein DiB2
-
SpeciesSynthetic
-
Insert Size (bp)534
-
GenBank ID
- Promoter araBAD
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-DiB2 was a gift from Alexander Mishin (Addgene plasmid # 168801 ; http://n2t.net/addgene:168801 ; RRID:Addgene_168801) -
For your References section:
Protein labeling for live cell fluorescence microscopy with a highly photostable renewable signal. Bozhanova NG, Baranov MS, Klementieva NV, Sarkisyan KS, Gavrikov AS, Yampolsky IV, Zagaynova EV, Lukyanov SA, Lukyanov KA, Mishin AS. Chem Sci. 2017 Oct 1;8(10):7138-7142. doi: 10.1039/c7sc01628j. Epub 2017 Aug 3. 10.1039/c7sc01628j PubMed 29147545