pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI
(Plasmid
#169097)
-
PurposeCas9 and Citrine expression in transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas9-2A-Citrine
-
Insert Size (bp)4962
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer agagttcgaagccttaagta
- 3′ sequencing primer aacaatttcacacaggaaac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG>nls-Cas9-nls-2A-Citrine-EcoRI/NotI was a gift from Marianne Bronner (Addgene plasmid # 169097 ; http://n2t.net/addgene:169097 ; RRID:Addgene_169097) -
For your References section:
A single-plasmid approach for genome editing coupled with long-term lineage analysis in chick embryos. Gandhi S, Li Y, Tang W, Christensen JB, Urrutia HA, Vieceli FM, Piacentino ML, Bronner ME. Development. 2021 Mar 9. pii: dev.193565. doi: 10.1242/dev.193565. 10.1242/dev.193565 PubMed 33688075