pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2)
(Plasmid
#169162)
-
PurposeBaculoviral transfer vector to express SARS-CoV-2 nsp10 in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBIG1b (biGBac)
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Spectinomycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namensp10-6His-3xFlag
-
Alt nameSf nsp10-HF
-
Alt nameSARS-CoV-2 nsp10 cofactor
-
SpeciesSynthetic; SARS-CoV-2
-
MutationCodon optimised for insect cells (Spodoptera frugiperda)
-
Entrez GeneORF1ab (a.k.a. GU280_gp01)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- 6His-3xFlag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Baculovirus generation using Tn7 transposition (Bac-to-Bac).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIG1b_nsp10-6His-3xFlag (SARS-CoV-2) was a gift from John Diffley (Addgene plasmid # 169162 ; http://n2t.net/addgene:169162 ; RRID:Addgene_169162) -
For your References section:
Identifying SARS-CoV-2 antiviral compounds by screening for small molecule inhibitors of nsp14/nsp10 exoribonuclease. Canal B, McClure AW, Curran JF, Wu M, Ulferts R, Weissmann F, Zeng J, Bertolin AP, Milligan JC, Basu S, Drury LS, Deegan TD, Fujisawa R, Roberts EL, Basier C, Labib K, Beale R, Howell M, Diffley JFX. Biochem J. 2021 Jul 16;478(13):2445-2464. doi: 10.1042/BCJ20210198. 10.1042/BCJ20210198 PubMed 34198326