6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B)
(Plasmid
#169168)
-
PurposeConjugatable form of LC3B lacking 5 C-terminal amino acids (MKLSV), with C-terminal Glycine120 exposed for lipidation reaction.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 169168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepETDuet1
-
Backbone manufacturerMerck
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 6518
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAP1LC3B
-
Alt nameLC3B; ATG8F; MAP1LC3B-a; MAP1A/1BLC3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1138
-
GenBank ID81631 NC_000016.10
-
Entrez GeneMAP1LC3B (a.k.a. ATG8F, LC3B, MAP1A/1BLC3, MAP1LC3B-a)
- Promoter T7 lac promoter
-
Tag
/ Fusion Protein
- 6X Histidine Tag, TEV cleavage site, mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site Notl (not destroyed)
- 5′ sequencing primer GTGAGCAAGGGCGAGGAG
- 3′ sequencing primer CCCGAACGTCTCCTGGGAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Internal construct reference: SMC-948
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
6xHis-TEV-mCherry-LC3B-Gly (Microtubule-associated proteins 1A/1B light chain 3B) was a gift from Sascha Martens (Addgene plasmid # 169168 ; http://n2t.net/addgene:169168 ; RRID:Addgene_169168) -
For your References section:
p62 filaments capture and present ubiquitinated cargos for autophagy. Zaffagnini G, Savova A, Danieli A, Romanov J, Tremel S, Ebner M, Peterbauer T, Sztacho M, Trapannone R, Tarafder AK, Sachse C, Martens S. EMBO J. 2018 Mar 1;37(5). pii: embj.201798308. doi: 10.15252/embj.201798308. Epub 2018 Jan 17. 10.15252/embj.201798308 PubMed 29343546