TVBB C-term-mNeongreen
(Plasmid
#169227)
-
PurposeTargeting vector backbone to support a knock-in of Linker-mNeongreen at the C-terminus of a target locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 169227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMinimalistic Amp + ColE1 backbone
- Backbone size w/o insert (bp) 1969
- Total vector size (bp) 2768
-
Modifications to backbonePCR amplified minimalistic backbone segment
-
Vector typeTargeting vector backbone
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrow at 30C for a few hours after overnight growth at 37C to amplify the plasmid copy number
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameDouble SapI flanked mNeongreen
-
SpeciesSynthetic
-
Insert Size (bp)799
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caaataggggttccgcgcac
- 3′ sequencing primer ttaccgcctttgagtgagctga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TVBB C-term-mNeongreen was a gift from Hugo Snippert (Addgene plasmid # 169227 ; http://n2t.net/addgene:169227 ; RRID:Addgene_169227) -
For your References section:
Efficient and error-free fluorescent gene tagging in human organoids without double-strand DNA cleavage. Bollen Y, Hageman JH, van Leenen P, Derks LLM, Ponsioen B, Buissant des Amorie JR, Verlaan-Klink I, van den Bos M, Terstappen LWMM, van Boxtel R, Snippert HJG. PLoS Biol. 2022 Jan 28;20(1):e3001527. doi: 10.1371/journal.pbio.3001527. 10.1371/journal.pbio.3001527 PubMed 35089911