Skip to main content
Addgene

pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry
(Plasmid #170184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170184 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
  • Backbone manufacturer
    Fraser lab
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Sa163 RT
  • Alt name
    RT-Sau1
  • Species
    Stigmatella aurantica
  • Promoter CBh
  • Tag / Fusion Protein
    • NLS (C terminal on backbone)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Retron Sa163 msr-msd
  • Alt name
    Retron Sau1 msr-msd
  • Species
    Stigmatella aurantica
  • Promoter hU6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer acttgatgtactgccaagtg
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    BFP-to-GFP conversion donor template An
  • Promoter hU6

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • 3′ sequencing primer acttgatgtactgccaagtg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry was a gift from Hunter Fraser (Addgene plasmid # 170184 ; http://n2t.net/addgene:170184 ; RRID:Addgene_170184)
  • For your References section:

    Bacterial Retrons Enable Precise Gene Editing in Human Cells. Zhao B, Chen SA, Lee J, Fraser HB. CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065. 10.1089/crispr.2021.0065 PubMed 35076284