slc1a3b:myrGFP-P2A-H2AmCherry
(Plasmid
#170208)
-
PurposeDrives myrGFP-P2A-H2AmCherry expression with the slc1a3b promoter in astrocytes. The myrGFP labels the membrane and mCherry labels the nucleus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepT2A
- Backbone size w/o insert (bp) 3299
- Total vector size (bp) 15280
-
Vector typeZebrafish
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameslc1a3b
-
Alt nameGlast
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)9550
-
Entrez Geneslc1a3b (a.k.a. EAAT, gla, si:dkey-21n12.2)
- Promoter slc1a3b
-
Tag
/ Fusion Protein
- myrGFP-P2A-H2AmCherry (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATTAACCCTCACTAAAGGGA
- 3′ sequencing primer CCCTATAGTGAGTCGTATTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
slc1a3b:myrGFP-P2A-H2AmCherry was a gift from Kelly Monk (Addgene plasmid # 170208 ; http://n2t.net/addgene:170208 ; RRID:Addgene_170208) -
For your References section:
Live-imaging of astrocyte morphogenesis and function in zebrafish neural circuits. Chen J, Poskanzer KE, Freeman MR, Monk KR. Nat Neurosci. 2020 Oct;23(10):1297-1306. doi: 10.1038/s41593-020-0703-x. Epub 2020 Sep 7. 10.1038/s41593-020-0703-x PubMed 32895565