Skip to main content

PCT62
(Plasmid #170391)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170391 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMJ114
  • Total vector size (bp) 9726
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PCT62-targetsite
  • Species
    Synthetic
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggtacagtgcaggggaaaga
  • 3′ sequencing primer ACGGCGACTACTGCACTTAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PCT62 was a gift from Jonathan Weissman (Addgene plasmid # 170391 ; http://n2t.net/addgene:170391 ; RRID:Addgene_170391)
  • For your References section:

    Single-cell lineages reveal the rates, routes, and drivers of metastasis in cancer xenografts. Quinn JJ, Jones MG, Okimoto RA, Nanjo S, Chan MM, Yosef N, Bivona TG, Weissman JS. Science. 2021 Feb 26;371(6532). pii: science.abc1944. doi: 10.1126/science.abc1944. Epub 2021 Jan 21. 10.1126/science.abc1944 PubMed 33479121