-
Purposeexpresses three sgRNA cassettes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170391 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMJ114
- Total vector size (bp) 9726
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePCT62-targetsite
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggtacagtgcaggggaaaga
- 3′ sequencing primer ACGGCGACTACTGCACTTAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PCT62 was a gift from Jonathan Weissman (Addgene plasmid # 170391 ; http://n2t.net/addgene:170391 ; RRID:Addgene_170391) -
For your References section:
Single-cell lineages reveal the rates, routes, and drivers of metastasis in cancer xenografts. Quinn JJ, Jones MG, Okimoto RA, Nanjo S, Chan MM, Yosef N, Bivona TG, Weissman JS. Science. 2021 Feb 26;371(6532). pii: science.abc1944. doi: 10.1126/science.abc1944. Epub 2021 Jan 21. 10.1126/science.abc1944 PubMed 33479121