pCW57-GFP-2A-Cas9
(Plasmid
#170805)
-
PurposeAll-in-one doxycycline inducible lentiviral vector for expression of Cas9 in combination with turbo GFP using the P2A self-cleaving peptide
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170805 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
Insert Size (bp)4104
-
Tags
/ Fusion Proteins
- NLS (N terminal on backbone)
- NLS (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byCloned from PX458-3xHA-SpCas9
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-GFP-2A-Cas9 was a gift from Morten Frodin (Addgene plasmid # 170805 ; http://n2t.net/addgene:170805 ; RRID:Addgene_170805) -
For your References section:
Multiparametric and accurate functional analysis of genetic sequence variants using CRISPR-Select. Niu Y, Ferreira Azevedo CA, Li X, Kamali E, Haagen Nielsen O, Storgaard Sorensen C, Frodin M. Nat Genet. 2022 Dec 5. doi: 10.1038/s41588-022-01224-7. 10.1038/s41588-022-01224-7 PubMed 36471068