Skip to main content

pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy)
(Plasmid #171089)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171089 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX330
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 9826
  • Vector type
    CRISPR ; Toxoplasma gondii expression
  • Selectable markers
    Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Decoy sgRNA
  • Alt name
    sgRNA NHE1 3′UTR
  • Alt name
    sgRNA#1
  • Species
    Synthetic; Streptococcus pyogenes, Toxoplasma gondii
  • Insert Size (bp)
    97
  • Promoter U6 (Toxoplasma gondii)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer ccggccgactctaaataggag
  • 3′ sequencing primer gcgggacatgcatggtac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    dCas9
  • Alt name
    Spy.dCas9
  • Alt name
    Streptococcus pyogenes dCas9
  • Species
    Synthetic; originally from Streptococcus pyogenes, human codon-optimized
  • Insert Size (bp)
    4101
  • Mutation
    D10A, H840A
  • Promoter TUB1 (Toxoplasma gondii)
  • Tags / Fusion Proteins
    • 3X FLAG (N terminal on backbone)
    • Nuclear Localization Signal (N terminal on backbone)
    • Nuclear Localization Signal (C terminal on backbone)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer aacccgcgcagaagacatcc
  • 3′ sequencing primer aacttcctgtacctggccagc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Chloramphenicol acetyltransferase
  • Alt name
    CAT
  • Species
    Shigella flexneri
  • Insert Size (bp)
    657
  • Promoter TUB1 (Toxoplasma gondii)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site PciI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer cgtaacacgccacatcttgc
  • 3′ sequencing primer gtgttcacccttgttacaccg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid was adapted from a construct previously published by Saima Sidik et al. (Addgene plasmid # 80323 ; A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes. Sidik SM, Huet D, Ganesan SM, Huynh MH, Wang T, Nasamu AS, Thiru P, Saeij JP, Carruthers VB, Niles JC, Lourido S. Cell. 2016 Sep 8;166(6):1423-1435.e12. doi: 10.1016/j.cell.2016.08.019. Epub 2016 Sep 2. 10.1016/j.cell.2016.08.019 PubMed 27594426)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTUB1-Spy.dCas9-CAT-U6-sgRNA(decoy) was a gift from Sebastian Lourido (Addgene plasmid # 171089 ; http://n2t.net/addgene:171089 ; RRID:Addgene_171089)
  • For your References section:

    CRISPR-Mediated Transcriptional Repression in Toxoplasma gondii. Markus BM, Boydston EA, Lourido S. mSphere. 2021 Oct 13:e0047421. doi: 10.1128/mSphere.00474-21. 10.1128/mSphere.00474-21 PubMed 34643425