Skip to main content

M-SPOTIT1.1
(Plasmid #171216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171216 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PLX208
  • Backbone size w/o insert (bp) 6783
  • Total vector size (bp) 9069
  • Modifications to backbone
    no Hygromycin
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    M-SPOTIT1.1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2286
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site MluI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    M-SPOTIT1.1 was a gift from Wenjing Wang (Addgene plasmid # 171216 ; http://n2t.net/addgene:171216 ; RRID:Addgene_171216)
  • For your References section:

    Designing a Single Protein-Chain Reporter for Opioid Detection at Cellular Resolution. Kroning KE, Wang W. Angew Chem Int Ed Engl. 2021 Mar 4. doi: 10.1002/anie.202101262. 10.1002/anie.202101262 PubMed 33662184