Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CBM9-ID-F
(Plasmid #171639)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171639 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pRSET5A
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 2900
  • Total vector size (bp) 3700
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    T7 Express lysY/Iq, NEB #C3013I
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike protein
  • Species
    SARS-CoV-2
  • Insert Size (bp)
    791
  • GenBank ID
    NC_045512.2 MZ322554
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Tag / Fusion Protein
    • CBM-9 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer AAGGTCAGCGTGTTGGTATC or nFseq5A GATCTCGATCCCGCGAAATTAATAC
  • 3′ sequencing primer nRseq5A AAACCCCTCAAGACCCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CBM9-ID-F was a gift from Francis Nano (Addgene plasmid # 171639 ; http://n2t.net/addgene:171639 ; RRID:Addgene_171639)