141_pT3TS_iCre
(Plasmid
#171793)
-
PurposePlasmid for optimised iCre RNA synthesis using T3 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDEST-T3TS-R1-R3
- Total vector size (bp) 4473
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameoptimised Cre for RNA expression
-
SpeciesSynthetic
- Promoter T3
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACTGGCCGTCGTTTTACA
- 3′ sequencing primer CAGGAAACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
141_pT3TS_iCre was a gift from Jean Giacomotto (Addgene plasmid # 171793 ; http://n2t.net/addgene:171793 ; RRID:Addgene_171793) -
For your References section:
Optimising the zebrafish Cre/Lox toolbox. Codon improved iCre, new gateway tools, Cre protein and guidelines. Tromp A, Wang H, Hall TE, Mowry B, Giacomotto J. Front Physiol. 2023 Aug 2;14:1221310. doi: 10.3389/fphys.2023.1221310. eCollection 2023. 10.3389/fphys.2023.1221310 PubMed 37601640