mNeonGreen-Smad3
(Plasmid
#172098)
-
PurposeExpresses fluorescently tagged human Smad3 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172098 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSuperBackbone
-
Backbone manufacturerNA
- Backbone size w/o insert (bp) 5129
- Total vector size (bp) 7118
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSmad 3
-
Alt nameSMAD family member 3
-
Alt nameMothers against decapentaplegic homolog 3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1989
-
MutationC49S mutation in mCerulean
-
GenBank IDNM_016769.4
-
Entrez GeneSmad3 (a.k.a. Madh3)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cttaccccaacgacaaaacc
- 3′ sequencing primer ACTTGTTTATTGCAGCTTATAATGGTTAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byHuman Smad3 cDNA was a gift from Joan Massague (Addgene plasmid #27010), mNeonGreen (NG) gene was obtained from Allele Biotechnology (ABP-FP-MNEONSA), mCerulean3-C1 cDNA was a gift from Klaus Hahn (Addgene plasmid #22030)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Human Smad3 and mouse Smad3 contain 100% sequence identity. The NG-Smad3 construct was placed downstream of a CMV promoter, and the mCerulean3 gene was fused with a 3× nuclear localization sequence (NLS) and placed downstream of an SV40 promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mNeonGreen-Smad3 was a gift from Lea Goentoro (Addgene plasmid # 172098 ; http://n2t.net/addgene:172098 ; RRID:Addgene_172098) -
For your References section:
Sensing relative signal in the Tgf-beta/Smad pathway. Frick CL, Yarka C, Nunns H, Goentoro L. Proc Natl Acad Sci U S A. 2017 Apr 4;114(14):E2975-E2982. doi: 10.1073/pnas.1611428114. Epub 2017 Mar 20. 10.1073/pnas.1611428114 PubMed 28320972