pKL2013
(Plasmid
#172182)
-
PurposeA CRISPR/Cas9 vector targeting maize glossy2 gene for targeted mutagenesis with a mCherry as fluorescent marker.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneA844B
-
Backbone manufacturerYiping Qi
- Backbone size w/o insert (bp) 16112
- Total vector size (bp) 17777
-
Vector typePlant Expression, CRISPR
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
-
Insert Size (bp)711
-
GenBank IDAJW76802.1
- Promoter Cauliflower mosaic virus 35S promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (destroyed during cloning)
- 3′ cloning site PacI (destroyed during cloning)
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer GTTGTGCAGATGATCCGTGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence differs from the depositor reference sequence. These discrepancies do not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKL2013 was a gift from Kan Wang (Addgene plasmid # 172182 ; http://n2t.net/addgene:172182 ; RRID:Addgene_172182) -
For your References section:
Development of a Transformable Fast-Flowering Mini-Maize as a Tool for Maize Gene Editing. McCaw ME, Lee K, Kang M, Zobrist JD, Azanu MK, Birchler JA, Wang K. Front Genome Ed. 2021 Jan 11;2:622227. doi: 10.3389/fgeed.2020.622227. eCollection 2020. 10.3389/fgeed.2020.622227 PubMed 34713243